Raltegravir

카탈로그 번호S2005 배치:S200504

인쇄

기술 자료

화학식

C₂₀H₂₁FN₆O₅

분자량

444.42

CAS 번호

518048-05-0

용해도 (25°C)*

시험관 내(In vitro)

DMSO

89 mg/mL (200.26 mM)

Water

Insoluble

Ethanol

Insoluble

생체 내(In Vivo) (개별적으로 순서대로 용매를 제품에 첨가하십시오.)

Homogeneous suspension

CMC-NA

≥5mg/ml

Taking the 1 mL working solution as an example, add 5 mg of this product to 1 ml of CMC-Na solution, mix evenly to obtain a homogeneous suspension with a final concentration of 5 mg/ml.

* <1 mg/ml은 약간 용해되거나 불용해됨을 의미합니다.
* Selleck은 모든 화합물의 용해도를 자체적으로 테스트하며, 실제 용해도는 게시된 값과 약간 다를 수 있습니다. 이는 정상적인 현상이며, 약간의 배치 간 변동으로 인해 발생합니다.
* 실온 배송 (안정성 테스트 결과 이 제품은 냉각 조치 없이 배송될 수 있음을 보여줍니다.)

원액 준비

생물학적 활성

설명

Raltegravir는 세포 무함유 분석에서 각각 90 nM 및 40 nM의 IC50을 나타내는 WT 및 S217Q PFV Integrase에 대한 강력한 Integrase (IN) 억제제입니다. 이는 HCV 폴리머라아제, HIV 역전사 효소, HIV RNaseH 및 인간 α-, β-, γ-폴리머라아제와 같은 여러 관련 Mg2+ 의존성 효소보다 HIV-1 Integrase에 대해 1000배 이상의 선택성을 보입니다.

표적

Integrase (S217Q PFV) (Cell-free assay)	Integrase (WT PFV) (Cell-free assay)
40 nM	90 nM

시험관 내(In vitro)

PFV IN carrying the S217H substitution is 10-fold less susceptible to Raltegravir with IC50 of 900 nM. PFV IN displays 10% of WT activity and is inhibited by this compound with an IC50 of 200 nM, indicating a ~twofold decrease in susceptibility to the IN strand transfer inhibitor (INSTI) compared with WT IN. S217Q PFV IN is as sensitive to this compound as the WT enzyme. It is metabolized by glucuronidation, not hepatically. This compound has potent in vitro activity against HIV-1, with a 95% inhibitory concentration of 31?0 nM, in human T lymphoid cell cultures. It is also active against HIV-2 when tested in CEMx174 cells, with an IC95 of 6 nM. Its metabolism occurs primarily through glucuronidation. Drugs that are strong inducers of the glucuronidation enzyme, UGT1A1, significantly reduce its concentrations and should not be used. It exhibits weak inhibitory effects on hepatic cytochrome P450 activity. It does not induce CYP3A4 RNA expression or CYP3A4-dependent testosterone 6-β-hydroxylase activity. Its cellular permeativity is reduced in the presence of magnesium and calcium. This compound and related HIV-1 integrase (IN) strand transfer inhibitors (INSTIs efficiently block viral replication. In acutely infected human lymphoid CD4+ T-cell lines MT-4 and CEMx174, SIVmac251 replication is efficiently inhibited by this compound, which shows an EC90 in the low nanomolar range.

생체 내(In Vivo)

Raltegravir induces viro-immunological improvement of nonhuman primates with progressing SIVmac251 infection. One non-human primate shows an undetectable viral load following this compound monotherapy.

특징

최초로 승인된 인체 면역결핍 바이러스 1형(HIV-1) Integrase 억제제.

프로토콜 (참조)

키나아제 분석:^{^[1]}	PFV Integrase 통합 분석 정량적 가닥 이동 분석을 위해, 공여체 DNA 기질은 HPLC 등급 올리고뉴클레오티드 5′-GACTCACTATAGGGCACGCGTCAAAATTCCATGACA 및 5′-ATTGTCATG GAATTTTGACGCGTGCCCTATAGTGAGTC를 어닐링하여 형성됩니다. 반응(40 μL)에는 0.75 μM PFV Integrase, 0.75 μM 공여체 DNA, 4 nM (300 ng) 초나선형 pGEM9-Zf(−) target DNA, 125 mM NaCl, 5 mM MgSO₄, 4 μM ZnCl₂, 10 mM DTT, 0.8%(vol/vol) DMSO 및 25 mM BisTris propane–HCl(pH 7.45)이 포함됩니다. Raltegravir는 표시된 농도로 첨가됩니다. 반응은 150 mM NaCl, 2 mM DTT 및 10 mM Tris-HCl(pH 7.4)에 희석된 2 μL PFV Integrase를 첨가하여 시작되며, 37 °C에서 1시간 후 25 mM EDTA 및 0.5%(wt/vol) SDS를 첨가하여 정지됩니다. 20 μg proteinase K로 37 °C에서 30분간 소화한 후 에탄올 침전법으로 탈단백질화된 반응 산물은 1.5% 아가로스 겔에서 분리되고 에티디움 브로마이드 염색으로 시각화됩니다. Integration 산물은 Platinum SYBR Green qPCR SuperMix와 세 가지 프라이머(5′-CTACTTACTCTAGCTTCCCGGCAAC, 5′-TTCGCCAGTTAATAGTTTGCGCAAC, 5′-GACTCACTATAGGGCACGCGT)를 사용하여 정량적 실시간 PCR로 정량화됩니다. PCR 반응(20 μL)에는 각 프라이머 0.5 μM과 1 μL의 희석된 Integration 반응 산물이 포함되었습니다. 95 °C에서 5분간 변성 단계를 거친 후, CFX96 PCR 기기에서 95 °C에서 10초간 변성, 56 °C에서 30초간 어닐링, 68 °C에서 1분간 신장을 포함하는 35 사이클을 수행합니다. 표준 곡선은 이 화합물이 없는 상태에서 WT PFV Integrase 반응의 연속 희석액을 사용하여 생성됩니다.
세포 분석:^{^[5]}	세포주 Human MT-4 cells 농도 0.0001-1 μM 배양 시간 5 days 방법 Human MT-4 cells are infected for 2 hours with the SIVmac251, HIV-1 (IIIB) and HIV-2 (CDC 77618) stocks at a multiplicity of infection of, approximately, 0.1. Cells are then washed three times in phosphate buffered saline, and suspended at 5 × 10⁵/mL in fresh culture medium (to primary cells 50 units/mL of IL-2 are added) in 96-well plates, in the presence or absence of a range of triplicate raltegravir concentrations (0.0001 μM -1 μM). Untreated infected and mock-infected controls are prepared too, in order to allow comparison of the data derived from the different treatments. Viral cytopathogeniciy in MT-4 cells is quantitated by the methyl tetrazolium (MTT) method (MT-4/MTT assay) when extensive cell death in control virus-infected cell cultures is detectable microscopically as lack of capacity to re-cluster. The capability of MT-4 cells to form clusters after infection. Briefly, clusters are disrupted by pipetting; and, after 2 hours of incubation at 37 °C, the formation of new clusters is assessed by light microscopy (100 × magnification). Cell culture supernatants are collected for HIV-1 p24 and HIV-2/SIVmac251 p27 core antigen measurement by ELISA. In CEMx174-infected cell cultures, which show a propensity to form syncytia induced by the virus envelope glycoproteins, syncytia are counted, in blinded fashion, by light microscopy for each well at 5 days following infection.
동물 연구:^{^[5]}	동물 모델 Indian Rhesus macaques 용량 50 mg/kg or 100 mg/kg 투여 Oral administration

참조

https://pubmed.ncbi.nlm.nih.gov/21030679/
https://pubmed.ncbi.nlm.nih.gov/19231980/
https://pubmed.ncbi.nlm.nih.gov/22450971/

https://pubmed.ncbi.nlm.nih.gov/21719464/
https://pubmed.ncbi.nlm.nih.gov/20233398/

펼치기

고객 제품 검증

: 데이터 출처 [ Vet Microbiol , 2011 , 152(1-2), 165-8 ]

: 데이터 출처 [ , , Antimicrob Agents Chemother, 2014, 58(8): 4431-42 ]

Selleck's Raltegravir 인용됨 82 출판물

Dual TLR2 and TLR7 agonists as HIV latency-reversing agents [ JCI Insight, October 04, 2018, e122673]	PubMed: 30282829
HMGB1 Expression Levels Correlate with Response to Immunotherapy in Non-Small Cell Lung Cancer [ Lung Cancer: Targets and Therapy, May 09, 2024, 55-67]	PubMed: 38741920
Screening of an FDA-Approved Compound Library Identifies Levosimendan as A Novel anti-HIV-1 Agent that Inhibits Viral Transcription [ EBioMedicine, August 24, 2017, 106-115]	PubMed: 28842263
Azvudine, A Novel Nucleoside Reverse Transcriptase Inhibitor Showed Good Drug Combination Features and Better Inhibition on Drug-Resistant Strains than Lamivudine In Vitro [ PLOS One, August 21, 2014, e105617]	PubMed: 25144636
A multisystem investigation of raltegravir association with intestinal tissue: implications for pre-exposure prophylaxis and eradication [ Journal of Antimicrobial Chemotherapy, August 11, 2014, 3275-3281]	PubMed: 25114168
Single-cell characterization of the gastrointestinal HIV reservoir reveals heterogeneous cellular phenotypes [ J Clin Invest, 2026, 136(4)e196536]	PubMed: 41433124
The macrophage-intrinsic MDA5/IRF5 axis drives HIV-1 intron-containing RNA-induced inflammatory responses [ J Clin Invest, 2025, 135(16)e187663]	PubMed: 40493408
Pomalidomide enhances CD8+ T and NK cell mediated killing of HIV-infected cells [ EBioMedicine, 2025, 122:106004]	PubMed: 41232235
Combined dendritic cell and anti-TIGIT immunotherapy potentiates adaptive NK cells against HIV-1 [ EMBO Mol Med, 2025, 10.1038/s44321-025-00255-x]	PubMed: 40473838
Targeting Ikaros and Aiolos with pomalidomide fails to reactivate or induce apoptosis of the latent HIV reservoir [ J Virol, 2025, e0167624.]	PubMed: 39902962

반품 정책
Selleck Chemical의 무조건 반품 정책은 고객에게 원활한 온라인 쇼핑 경험을 보장합니다. 구매에 어떤 식으로든 불만족하시면, 수령일로부터 7일 이내에 모든 품목을 반품하실 수 있습니다. 제품 품질 문제(프로토콜 관련 문제 또는 제품 관련 문제)가 발생하는 경우, 원래 구매일로부터 365일 이내에 모든 품목을 반품하실 수 있습니다. 제품 반품 시 아래 지침을 따르십시오.

배송 및 보관
Selleck 제품은 실온에서 운송됩니다. 실온에서 제품을 받으셨더라도 안심하십시오. Selleck 품질 검사 부서에서 한 달간의 상온 보관이 분말 제품의 생물학적 활성에 영향을 미치지 않음을 확인하는 실험을 수행했습니다. 수령 후, 데이터시트에 설명된 요구 사항에 따라 제품을 보관하십시오. 대부분의 Selleck 제품은 권장 조건에서 안정적입니다.

인간, 수의학 진단 또는 치료 용도로 사용하지 마십시오.