Raltegravir

정량적 가닥 전이 분석을 위해, 공여 DNA 기질은 HPLC 등급 올리고뉴클레오티드 5′-GACTCACTATAGGGCACGCGTCAAAATTCCATGACA 및 5′-ATTGTCATG GAATTTTGACGCGTGCCCTATAGTGAGTC의 어닐링을 통해 형성됩니다. 반응물(40 μL)은 0.75 μM PFV IN, 0.75 μM 공여 DNA, 4 nM (300 ng) 초나선 pGEM9-Zf(−) target DNA, 125 mM NaCl, 5 mM MgSO₄, 4 μM ZnCl₂, 10 mM DTT, 0.8% (vol/vol) DMSO, 및 25 mM BisTris propane–HCl, pH 7.45를 포함합니다. Raltegravir는 지정된 농도로 첨가됩니다. 반응은 150 mM NaCl, 2 mM DTT, 및 10 mM Tris-HCl, pH 7.4에 희석된 2 μL PFV IN을 첨가하여 시작되고, 37 °C에서 1시간 후 25 mM EDTA 및 0.5% (wt/vol) SDS를 첨가하여 중단됩니다. 20 μg 프로테이나제 K로 30분간 37 °C에서 소화시킨 후 에탄올 침전으로 탈단백질화된 반응 산물은 1.5% 아가로스 겔에서 분리되고 에티듐 브로마이드 염색으로 시각화됩니다. 통합 산물은 Platinum SYBR Green qPCR SuperMix 및 세 가지 프라이머: 5′-CTACTTACTCTAGCTTCCCGGCAAC, 5′-TTCGCCAGTTAATAGTTTGCGCAAC, 및 5′-GACTCACTATAGGGCACGCGT를 사용하여 정량적 실시간 PCR로 정량화됩니다. PCR 반응물(20 μL)은 각 프라이머 0.5 μM 및 희석된 통합 반응 산물 1 μL를 포함했습니다. 95 °C에서 5분간 변성 단계 후, CFX96 PCR 기기에서 35 사이클이 수행되었으며, 95 °C에서 10초 변성, 56 °C에서 30초 어닐링, 68 °C에서 1분 연장을 사용했습니다. 표준 곡선은 이 화합물이 없는 상태에서 WT PFV IN 반응의 연속 희석을 사용하여 생성됩니다.

Human MT-4 cells

0.0001-1 μM

5 days

Human MT-4 cells are infected for 2 hours with the SIVmac251, HIV-1 (IIIB) and HIV-2 (CDC 77618) stocks at a multiplicity of infection of, approximately, 0.1. Cells are then washed three times in phosphate buffered saline, and suspended at 5 × 10⁵/mL in fresh culture medium (to primary cells 50 units/mL of IL-2 are added) in 96-well plates, in the presence or absence of a range of triplicate raltegravir concentrations (0.0001 μM -1 μM). Untreated infected and mock-infected controls are prepared too, in order to allow comparison of the data derived from the different treatments. Viral cytopathogeniciy in MT-4 cells is quantitated by the methyl tetrazolium (MTT) method (MT-4/MTT assay) when extensive cell death in control virus-infected cell cultures is detectable microscopically as lack of capacity to re-cluster. The capability of MT-4 cells to form clusters after infection. Briefly, clusters are disrupted by pipetting; and, after 2 hours of incubation at 37 °C, the formation of new clusters is assessed by light microscopy (100 × magnification). Cell culture supernatants are collected for HIV-1 p24 and HIV-2/SIVmac251 p27 core antigen measurement by ELISA. In CEMx174-infected cell cultures, which show a propensity to form syncytia induced by the virus envelope glycoproteins, syncytia are counted, in blinded fashion, by light microscopy for each well at 5 days following infection.

Indian Rhesus macaques

50 mg/kg or 100 mg/kg

Oral administration