Raltegravir

카탈로그 번호S2005 배치:S200506

인쇄

기술 자료

화학식

C20H21FN6O5

분자량 444.42 CAS 번호 518048-05-0
용해도 (25°C)* 시험관 내(In vitro) DMSO 89 mg/mL (200.26 mM)
Water Insoluble
Ethanol Insoluble
생체 내(In Vivo) (개별적으로 순서대로 용매를 제품에 첨가하십시오.)
Homogeneous suspension
CMC-NA
≥5mg/ml Taking the 1 mL working solution as an example, add 5 mg of this product to 1 ml of CMC-Na solution, mix evenly to obtain a homogeneous suspension with a final concentration of 5 mg/ml.
* <1 mg/ml은 약간 용해되거나 불용해됨을 의미합니다.
* Selleck은 모든 화합물의 용해도를 자체적으로 테스트하며, 실제 용해도는 게시된 값과 약간 다를 수 있습니다. 이는 정상적인 현상이며, 약간의 배치 간 변동으로 인해 발생합니다.
* 실온 배송 (안정성 테스트 결과 이 제품은 냉각 조치 없이 배송될 수 있음을 보여줍니다.)

원액 준비

생물학적 활성

설명 Raltegravir는 WT 및 S217Q PFV IN에 대한 강력한 integrase (IN) 억제제로, 세포-자유 분석에서 각각 90 nM 및 40 nM의 IC50를 보입니다. 이는 HCV polymerase, HIV reverse transcriptase, HIV RNaseH 및 인간 α-, β-, γ-polymerase와 같은 여러 관련 Mg2+-의존성 효소에 비해 HIV-1 IN에 대해 1000배 이상의 선택성을 보입니다.
표적
Integrase (S217Q PFV)
(Cell-free assay)
Integrase (WT PFV)
(Cell-free assay)
40 nM 90 nM
시험관 내(In vitro) S217H 치환을 가진 PFV IN은 Raltegravir에 대해 10배 덜 민감하며 IC50는 900 nM입니다. PFV IN은 WT 활성의 10%를 나타내며 이 화합물에 의해 200 nM의 IC50로 억제되어, WT IN에 비해 IN 가닥 전달 억제제(INSTI)에 대한 민감도가 약 2배 감소함을 나타냅니다. S217Q PFV IN은 WT 효소만큼 이 화합물에 민감합니다. 이는 간에서가 아닌 글루쿠론산 포합에 의해 대사됩니다. 이 화합물은 인간 T 림프구 세포 배양에서 HIV-1에 대해 강력한 시험관 내 활성을 가지며, 95% 억제 농도는 31?0 nM입니다. CEMx174 세포에서 테스트했을 때 HIV-2에 대해서도 활성이 있으며, IC95는 6 nM입니다. 그 대사는 주로 글루쿠론산 포합을 통해 일어납니다. 글루쿠론산 포합 효소 UGT1A1의 강력한 유도제인 약물은 그 농도를 현저히 감소시키므로 사용해서는 안 됩니다. 이는 간 시토크롬 P450 활성에 약한 억제 효과를 나타냅니다. CYP3A4 RNA 발현 또는 CYP3A4 의존성 테스토스테론 6-β-수산화효소 활성을 유도하지 않습니다. 마그네슘과 칼슘 존재 시 세포 투과성이 감소합니다. 이 화합물과 관련 HIV-1 integrase (IN) 가닥 전달 억제제 (INSTI)는 바이러스 복제를 효율적으로 차단합니다. 급성 감염된 인간 림프구 CD4+ T-세포주 MT-4 및 CEMx174에서 SIVmac251 복제는 이 화합물에 의해 효율적으로 억제되며, 낮은 나노몰 범위의 EC90를 보입니다.
생체 내(In Vivo) Raltegravir는 SIVmac251 감염이 진행 중인 비인간 영장류의 바이러스-면역학적 개선을 유도합니다. 한 비인간 영장류는 이 화합물 단일 요법 후 검출 불가능한 바이러스 부하를 보입니다.
특징 최초로 승인된 인간 면역결핍 바이러스 유형 1(HIV-1) integrase 억제제.

프로토콜 (참조)

키나아제 분석:

[1]

  • PFV 통합 분석

    정량적 가닥 전이 분석을 위해, 공여 DNA 기질은 HPLC 등급 올리고뉴클레오티드 5′-GACTCACTATAGGGCACGCGTCAAAATTCCATGACA 및 5′-ATTGTCATG GAATTTTGACGCGTGCCCTATAGTGAGTC의 어닐링을 통해 형성됩니다. 반응물(40 μL)은 0.75 μM PFV IN, 0.75 μM 공여 DNA, 4 nM (300 ng) 초나선 pGEM9-Zf(−) target DNA, 125 mM NaCl, 5 mM MgSO4, 4 μM ZnCl2, 10 mM DTT, 0.8% (vol/vol) DMSO, 및 25 mM BisTris propane–HCl, pH 7.45를 포함합니다. Raltegravir는 지정된 농도로 첨가됩니다. 반응은 150 mM NaCl, 2 mM DTT, 및 10 mM Tris-HCl, pH 7.4에 희석된 2 μL PFV IN을 첨가하여 시작되고, 37 °C에서 1시간 후 25 mM EDTA 및 0.5% (wt/vol) SDS를 첨가하여 중단됩니다. 20 μg 프로테이나제 K로 30분간 37 °C에서 소화시킨 후 에탄올 침전으로 탈단백질화된 반응 산물은 1.5% 아가로스 겔에서 분리되고 에티듐 브로마이드 염색으로 시각화됩니다. 통합 산물은 Platinum SYBR Green qPCR SuperMix 및 세 가지 프라이머: 5′-CTACTTACTCTAGCTTCCCGGCAAC, 5′-TTCGCCAGTTAATAGTTTGCGCAAC, 및 5′-GACTCACTATAGGGCACGCGT를 사용하여 정량적 실시간 PCR로 정량화됩니다. PCR 반응물(20 μL)은 각 프라이머 0.5 μM 및 희석된 통합 반응 산물 1 μL를 포함했습니다. 95 °C에서 5분간 변성 단계 후, CFX96 PCR 기기에서 35 사이클이 수행되었으며, 95 °C에서 10초 변성, 56 °C에서 30초 어닐링, 68 °C에서 1분 연장을 사용했습니다. 표준 곡선은 이 화합물이 없는 상태에서 WT PFV IN 반응의 연속 희석을 사용하여 생성됩니다.

세포 분석:

[5]

  • 세포주

    Human MT-4 cells

  • 농도

    0.0001-1 μM

  • 배양 시간

    5 days

  • 방법

    Human MT-4 cells are infected for 2 hours with the SIVmac251, HIV-1 (IIIB) and HIV-2 (CDC 77618) stocks at a multiplicity of infection of, approximately, 0.1. Cells are then washed three times in phosphate buffered saline, and suspended at 5 × 105/mL in fresh culture medium (to primary cells 50 units/mL of IL-2 are added) in 96-well plates, in the presence or absence of a range of triplicate raltegravir concentrations (0.0001 μM -1 μM). Untreated infected and mock-infected controls are prepared too, in order to allow comparison of the data derived from the different treatments. Viral cytopathogeniciy in MT-4 cells is quantitated by the methyl tetrazolium (MTT) method (MT-4/MTT assay) when extensive cell death in control virus-infected cell cultures is detectable microscopically as lack of capacity to re-cluster. The capability of MT-4 cells to form clusters after infection. Briefly, clusters are disrupted by pipetting; and, after 2 hours of incubation at 37 °C, the formation of new clusters is assessed by light microscopy (100 × magnification). Cell culture supernatants are collected for HIV-1 p24 and HIV-2/SIVmac251 p27 core antigen measurement by ELISA. In CEMx174-infected cell cultures, which show a propensity to form syncytia induced by the virus envelope glycoproteins, syncytia are counted, in blinded fashion, by light microscopy for each well at 5 days following infection.

동물 연구:

[5]

  • 동물 모델

    Indian Rhesus macaques

  • 용량

    50 mg/kg or 100 mg/kg

  • 투여

    Oral administration

참조

  • https://pubmed.ncbi.nlm.nih.gov/21030679/
  • https://pubmed.ncbi.nlm.nih.gov/19231980/
  • https://pubmed.ncbi.nlm.nih.gov/22450971/
  • https://pubmed.ncbi.nlm.nih.gov/21719464/
  • https://pubmed.ncbi.nlm.nih.gov/20233398/

고객 제품 검증

데이터 출처 [ Vet Microbiol , 2011 , 152(1-2), 165-8 ]

a: HCV, hepatitis C virus; HBV, hepatitis B virus. B: PI, protease inhibitor; NRTI, nucleoside reverse transcriptase inhibitor; NNRTI, nonnucleoside reverse transcriptase inhibitor; IN, integrase inhibitor. c: n=3. d: The EC50 for samatasvir in the presence of 45% human serum was 25 pM.

데이터 출처 [ , , Antimicrob Agents Chemother, 2014, 58(8): 4431-42 ]

Sellecks Raltegravir 인용됨 76 출판물

The macrophage-intrinsic MDA5/IRF5 axis drives HIV-1 intron-containing RNA-induced inflammatory responses [ J Clin Invest, 2025, 135(16)e187663] PubMed: 40493408
Pomalidomide enhances CD8+ T and NK cell mediated killing of HIV-infected cells [ EBioMedicine, 2025, 122:106004] PubMed: 41232235
Combined dendritic cell and anti-TIGIT immunotherapy potentiates adaptive NK cells against HIV-1 [ EMBO Mol Med, 2025, 10.1038/s44321-025-00255-x] PubMed: 40473838
Targeting Ikaros and Aiolos with pomalidomide fails to reactivate or induce apoptosis of the latent HIV reservoir [ J Virol, 2025, e0167624.] PubMed: 39902962
Limitations and use of the Morpheus-V5 dual reporter virus in assessing interventions that target HIV latency [ J Virol Methods, 2025, 338:115236] PubMed: 40754007
5' cap sequestration is required for sensing of unspliced HIV-1 RNA by MDA5 [ bioRxiv, 2025, 2025.08.20.671346] PubMed: 40909469
IKAROS expression drives the aberrant metabolic phenotype of macrophages in chronic HIV infection [ Clin Immunol, 2024, 260:109915] PubMed: 38286172
Broad synergistic antiviral efficacy between a novel elite controller-derived dipeptide and antiretrovirals against drug-resistant HIV-1 [ Front Cell Infect Microbiol, 2024, 14:1334126] PubMed: 38915925
HMGB1 Expression Levels Correlate with Response to Immunotherapy in Non-Small Cell Lung Cancer [ Lung Cancer, 2024, 15:55-67] PubMed: 38741920
Conversion of raltegravir carrying a 1,3,4-oxadiazole ring to a hydrolysis product upon pH changes decreases its antiviral activity [ PNAS Nexus, 2024, 3(1):pgad446] PubMed: 38170115

반품 정책
Selleck Chemical의 무조건 반품 정책은 고객에게 원활한 온라인 쇼핑 경험을 보장합니다. 구매에 어떤 식으로든 불만족하시면, 수령일로부터 7일 이내에 모든 품목을 반품하실 수 있습니다. 제품 품질 문제(프로토콜 관련 문제 또는 제품 관련 문제)가 발생하는 경우, 원래 구매일로부터 365일 이내에 모든 품목을 반품하실 수 있습니다. 제품 반품 시 아래 지침을 따르십시오.

배송 및 보관
Selleck 제품은 실온에서 운송됩니다. 실온에서 제품을 받으셨더라도 안심하십시오. Selleck 품질 검사 부서에서 한 달간의 상온 보관이 분말 제품의 생물학적 활성에 영향을 미치지 않음을 확인하는 실험을 수행했습니다. 수령 후, 데이터시트에 설명된 요구 사항에 따라 제품을 보관하십시오. 대부분의 Selleck 제품은 권장 조건에서 안정적입니다.

인간, 수의학 진단 또는 치료 용도로 사용하지 마십시오.