UNC1999

카탈로그 번호S7165 배치:S716504

인쇄

기술 자료

화학식

C33H43N7O2

분자량 569.74 CAS 번호 1431612-23-5
용해도 (25°C)* 시험관 내(In vitro) DMSO 100 mg/mL (175.51 mM)
Ethanol 100 mg/mL (175.51 mM)
Water Insoluble
생체 내(In Vivo) (개별적으로 순서대로 용매를 제품에 첨가하십시오.)
Homogeneous suspension
CMC-NA
≥5mg/ml Taking the 1 mL working solution as an example, add 5 mg of this product to 1 ml of CMC-Na solution, mix evenly to obtain a homogeneous suspension with a final concentration of 5 mg/ml.
Clear solution
5%DMSO 40%PEG300 5%Tween80 50%ddH2O

Selleck 연구소에서 검증했습니다. 이 제형에 대한 조정이 필요한 경우 맞춤형 테스트를 위해 당사 영업팀에 문의하십시오.

5.000mg/ml (8.78mM) Taking the 1 mL working solution as an example, add 50 μL of 100 mg/ml clarified DMSO stock solution to 400 μL of PEG300, mix evenly to clarify it; add 50 μL of Tween80 to the above system, mix evenly to clarify; then continue to add 500 μL of ddH2O to adjust the volume to 1 mL. The mixed solution should be used immediately for optimal results. 
Clear solution
5% DMSO 95% Corn oil

Selleck 연구소에서 검증했습니다. 이 제형에 대한 조정이 필요한 경우 맞춤형 테스트를 위해 당사 영업팀에 문의하십시오.

1.250mg/ml (2.19mM) Taking the 1 mL working solution as an example, add 50 μL of 25 mg/ml clear DMSO stock solution to 950 μL of corn oil and mix evenly. The mixed solution should be used immediately for optimal results. 
* <1 mg/ml은 약간 용해되거나 불용해됨을 의미합니다.
* Selleck은 모든 화합물의 용해도를 자체적으로 테스트하며, 실제 용해도는 게시된 값과 약간 다를 수 있습니다. 이는 정상적인 현상이며, 약간의 배치 간 변동으로 인해 발생합니다.
* 실온 배송 (안정성 테스트 결과 이 제품은 냉각 조치 없이 배송될 수 있음을 보여줍니다.)

원액 준비

생물학적 활성

설명 UNC1999는 세포 자유 분석에서 EZH2EZH1의 강력하고 경구 생체 이용률이 높으며 선택적인 억제제로, 각각 2 nM 및 45 nM의 IC50을 가지며, 광범위한 후성유전학적 및 비후성유전학적 표적에 대해 1000배 이상의 선택성을 보입니다. 이 화합물은 강력한 autophagy 유도제입니다. H3K27me3/2를 특이적으로 억제하고 항증식, 분화 및 apoptosis를 포함한 다양한 항백혈병 효과를 유도합니다.
표적
EZH2
(Cell-free assay)
EZH1
(Cell-free assay)
2 nM 45 nM
시험관 내(In vitro) UNC1999는 시험관 내에서 EZH2 Y641N 및 EZH2 Y641F 돌연변이 모두에 대해 높은 효능을 가집니다. 이 화합물은 MCF10A 세포에서 H3K27me3의 농도 의존적 감소를 유발하며 IC50은 124 nM이지만, 낮은 세포 독성을 보입니다. EZH2Y641N 돌연변이를 포함하는 DLBCL 세포주에서 EC50이 633 nM인 강력하고 농도 의존적인 세포 증식 억제를 나타냅니다. 또한, 생체 표지된 UNC1999는 HEK293T 세포 용해물에서 EZH2를 풍부하게 하며, 따라서 화학단백질체학 연구에 사용될 수 있습니다.
생체 내(In Vivo) UNC1999 (150 및 50 mg/kg, i.p.)의 처리는 생체 내에서 24시간 동안 이 화합물의 혈장 농도가 세포 IC50 이상으로 나타나는 결과를 가져옵니다. 또한, 쥐에서도 경구 생체 이용률이 있어 만성 동물 연구를 더 실용적이고 편리하게 만듭니다.
특징 야생형 및 돌연변이 EZH2와 EZH1에 대한 최초의 경구 생체 이용률이 있는 억제제.

프로토콜 (참조)

키나아제 분석:

[1]

  • 섬광 근접 분석

    메틸전달효소 활성 분석은 PRC2-EZH2 삼량체 복합체 (EZH2:EED:SUZ12), PRC2-EZH1 오량체 복합체 (EZH1:EED:SUZ12:RBBP4:AEBP2), SETD7, G9a, GLP, SETDB1, SETD8, SUV420H1, SUV420H2, SUV39H2, MLL1 사량체 복합체 (MLL:WDR5:RbBP5:ASH2L), PRMT1, PRMT3, PRMT5-MEP50 복합체 및 SMYD2에 대한 섬광 근접 분석(SPA)을 사용하여 S-아데노실메티오닌 (3H-SAM)으로부터 생체 표지된 펩타이드 기질로 삼중수소 표지된 메틸 그룹의 통합을 모니터링하여 수행됩니다. SMYD2 및 SMYD3에 대한 반응 완충액은 50 mM Tris pH 9.0, 5 mM DTT, 0.01% TritonX-100; G9a, GLP 및 SUV39H2에 대한 반응 완충액은 25 mM 인산칼륨 pH 8.0, 1 mM EDTA, 2 mM MgCl2 및 0.01% Triton X-100; 다른 HMT에 대한 반응 완충액은 20 mM Tris pH 8.0, 5 mM DTT, 0.01% TritonX-100입니다. 효소 반응을 중지시키기 위해 10 μL의 7.5 M 염산 구아니딘을 첨가하고, 이어서 180 μL의 완충액을 첨가하고 혼합한 후 384웰 FlashPlate로 옮깁니다. 혼합 후, 반응 혼합물을 인큐베이션하고 Topcount 플레이트 리더를 사용하여 CPM 수를 측정합니다. 각 데이터 세트에서 이 화합물이 없을 때의 CPM 수는 100% 활성으로 정의됩니다. 효소가 없을 때, 각 데이터 세트의 CPM 수는 배경 (0%)으로 정의됩니다. IC50 값은 100 nM에서 100 μM 범위의 화합물 농도를 사용하여 결정됩니다. IC50 값은 SigmaPlot 소프트웨어를 사용하여 결정됩니다. EZH2-Y641F 분석은 20 mM Tris pH 8, 5 mM DTT, 0.01% Triton X-100, 5 μM SAM 및 1 μM H3 (1-24) 펩타이드 (야생형 PRC2-EZH2 복합체와 동일)에서 30 nM 효소를 사용하여 수행됩니다. DNMT1의 경우, 분석은 헤미메틸화된 dsDNA를 기질로 사용하여 수행됩니다. dsDNA 기질은 Eurofins MWG Operon에서 합성한 두 개의 상보적 가닥 (생체 표지된 순방향 가닥: BGAGCCCGTAAGCCCGTTCAGGTCG 및 역방향 가닥: CGACCTGAACGGGCTTACGGGCTC)을 어닐링하여 준비됩니다. 반응 완충액은 20 mM Tris-HCl, pH 8.0, 5mM DTT, 0.01% Triton X-100입니다. DOT1L에 대한 메틸전달효소 활성 분석은 필터 플레이트를 사용하여 수행됩니다. 20 mM Tris-HCl, pH 8.0, 5 mM DTT, 2 mM MgCl2 및 0.01% Triton X-100의 반응 혼합물을 실온에서 1시간 동안 인큐베이션하고, 100 μL의 10% TCA를 첨가하고 혼합한 후 필터 플레이트로 옮깁니다. 플레이트는 2분 동안 2000 rpm으로 원심분리한 후 2번의 추가 10% TCA 세척과 한 번의 에탄올 세척 (180 μL)을 거쳐 원심분리합니다. 플레이트를 건조하고 100 μL의 MicroO를 첨가하고 원심분리합니다. 70 μL의 MicroO를 첨가하고 Topcount 플레이트 리더를 사용하여 CPM을 측정합니다.

세포 분석:

[1]

  • 세포주

    DLBCL cell line harboring the EZH2Y641N mutant

  • 농도

    ~5 μM

  • 배양 시간

    8 days

  • 방법

    DB cells, a diffuse-large B-cell lymphoma cell line harboring the EZH2 Y641N mutation, are obtained from ATCC and cultured in RPMI 1640 supplemented with 10% fetal bovine serum, antibiotics, and various concentrations of compounds (DMSO control, UNC1999, or UNC2400). The medium containing the test compound or control is refreshed every 3 days. The numbers of viable cells from at least three independent experiments are measured using TC20 automated cell counter system. Total histones are prepared from cell nuclei using an acidic extraction protocol. About 1 μg of total histones is separated using 15% SDS-PAGE, transferred to PVDF membranes, and probed with histone antibodies. Antibodies used in this study are those against EZH2, general H3, and H3K27me3.

동물 연구:

[1]

  • 동물 모델

    Male Swiss albino mice

  • 용량

    ~150 mg/kg (i.p.), ~50 mg/kg (oral)

  • 투여

    Intraperitoneal administration or oral administration

참조

  • https://pubmed.ncbi.nlm.nih.gov/23614352/
  • http://www.thesgc.org/chemical-probes/UNC1999

고객 제품 검증

Ex vivo growth of the SCLC PDX LX92 is significantly inhibited by the EZH2 inhibitors EPZ-5687, GSK343 and UNC1999 as measured by resazurin conversion (two-way analysis of variance, adjusted for multiple comparisons by the method of Dunnet).

데이터 출처 [ , , Oncogene, 2015, 10.1038/onc.2015.38 ]

A. Treatment with UNC1999 (4-6 μM) reduces viable cell numbers in BT73 as assessed by trypan blue exclusion (n=3; ** P<0.01). B. Treatment with varying concentrations of UNC1999 impairs self renewal in BT73 and BT147 as assessed by sphere assay (n=3).

데이터 출처 [ , , Oncotarget, 2016, 7(37):59360-59376 ]

Sellecks UNC1999 인용됨 34 출판물

Inhibition of PRC2 enables self-renewal of blastoid-competent naive pluripotent stem cells from chimpanzee [ Cell Stem Cell, 2025, S1934-5909(25)00041-4] PubMed: 40015279
Chromatin modification abnormalities by CHD7 and KMT2C loss promote medulloblastoma progression [ Cell Rep, 2025, 44(5):115673] PubMed: 40393452
Epigenetic modifiers to treat retinal degenerative diseases [ bioRxiv, 2025, 2025.05.22.655558] PubMed: 40501782
LSD1 inhibition improves efficacy of adoptive T cell therapy by enhancing CD8+ T cell responsiveness [ Nat Commun, 2024, 15(1):7366] PubMed: 39191730
Ezh2 Delays Activation of Differentiation Genes During Normal Cerebellar Granule Neuron Development and in Medulloblastoma [ bioRxiv, 2024, 2024.11.21.624171] PubMed: 39605517
Hedgehog pathway orchestrates the interplay of histone modifications and tailors combination epigenetic therapies in breast cancer [ Acta Pharm Sin B, 2023, 13(6):2601-2612] PubMed: 37425067
EZH2-H3K27me3-mediated silencing of mir-139-5p inhibits cellular senescence in hepatocellular carcinoma by activating TOP2A [ J Exp Clin Cancer Res, 2023, 42(1):320] PubMed: 38008711
BRD4770 functions as a novel ferroptosis inhibitor to protect against aortic dissection [ Pharmacol Res, 2022, 177:106122] PubMed: 35149187
Dual targeting of EZH1 and EZH2 for the treatment of malignant rhabdoid tumors [ Mol Ther Oncolytics, 2022, 27:14-25] PubMed: 36212776
Enhanced Calcium Signal Induces NK Cell Degranulation but Inhibits Its Cytotoxic Activity [ J Immunol, 2022, 208(2):347-357] PubMed: 34911773

반품 정책
Selleck Chemical의 무조건 반품 정책은 고객에게 원활한 온라인 쇼핑 경험을 보장합니다. 구매에 어떤 식으로든 불만족하시면, 수령일로부터 7일 이내에 모든 품목을 반품하실 수 있습니다. 제품 품질 문제(프로토콜 관련 문제 또는 제품 관련 문제)가 발생하는 경우, 원래 구매일로부터 365일 이내에 모든 품목을 반품하실 수 있습니다. 제품 반품 시 아래 지침을 따르십시오.

배송 및 보관
Selleck 제품은 실온에서 운송됩니다. 실온에서 제품을 받으셨더라도 안심하십시오. Selleck 품질 검사 부서에서 한 달간의 상온 보관이 분말 제품의 생물학적 활성에 영향을 미치지 않음을 확인하는 실험을 수행했습니다. 수령 후, 데이터시트에 설명된 요구 사항에 따라 제품을 보관하십시오. 대부분의 Selleck 제품은 권장 조건에서 안정적입니다.

인간, 수의학 진단 또는 치료 용도로 사용하지 마십시오.